Sequence ID | >SRA1015811 |
Genome ID | SRR023846.208315 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 206 |
End posion on genome | 131 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
acggctcgcg |
tRNA gene sequence |
GTGGGTATAGCTCAGCTGGTAGAGCGCCGCCTTGTGGTGGCGGATGTCGCGGGTTCAAGT |
Downstream region at tRNA end position |
gacagctgtc |
Secondary structure (Cloverleaf model) | >SRA1015811 His GTG g CCCA gacagctgtc G - C T - A G - C G + T G - C T - A A - T T G T T G C C C A C G A A + | | | | A T C T C G G C G G G C G | | | | T T G G A G C T A G ATGTC C - G C - G G - C C - G C - G T T T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |