Sequence ID | >SRA1015821 |
Genome ID | SRR023846.211984 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 188 |
End posion on genome | 270 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
caacgcacgc |
tRNA gene sequence |
GGCGGGTTGCCCGAGTGGCCAATGGGAGCGGACTGTAAATCCGCCGGCTTAGCCTTCGAA |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >SRA1015821 Tyr GTA c ACgn nnnnnnnnnn G - C G - C C - G G - C G - C G - C T - A T A T C T T C C A T G A G | | | | | G G G C C C G A A G G C G + | | | T T C T G G G C A A A CGGCTTAGCCTTC G - C C - G G - C G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |