Sequence ID | >SRA1015860 |
Genome ID | SRR023846.232587 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 200 |
End posion on genome | 126 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
cgccctgcgg |
tRNA gene sequence |
GGGCGCGTAGCTCAATGGTGGAGCTAGCCGCTCATAACGGCCAGGTTGCAGGTTCGAGTC |
Downstream region at tRNA end position |
cacccgcttc |
Secondary structure (Cloverleaf model) | >SRA1015860 Met CAT g ACCA cacccgcttc G + T G - C G - C C - G G - C C - G G - C T G T C G T C C A A A A | | | | | G T C T C G G C A G G C G | | | | T T G G A G C T G T AGGTT A C G - C C - G C - G G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |