Sequence ID | >SRA1015963 |
Genome ID | SRR023846.286093 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 138 |
End posion on genome | 214 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
gccgcagcgc |
tRNA gene sequence |
GCGCCCGTAGCTCAGCTGGATAGAGCAAGGAGCTTCTACCTCCTCGGTCGGGGGTTCGAA |
Downstream region at tRNA end position |
atcgcctgcc |
Secondary structure (Cloverleaf model) | >SRA1015963 Arg TCT c GCCA atcgcctgcc G - C C - G G - C C - G C - G C - G G - C C A T C T C C C A C G A A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C A T A A CGGTC A - T G - C G - C A - T G - C C C T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |