Sequence ID | >SRA1015976 |
Genome ID | SRR023846.292133 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 150 |
End posion on genome | 75 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
cacagtgatg |
tRNA gene sequence |
GTGGGCGTAGTTCAGTTGGTAGAGCACCAGGTTGTGATCCTGGCTGTCGCGGGTTCGAGT |
Downstream region at tRNA end position |
aacagaaagg |
Secondary structure (Cloverleaf model) | >SRA1015976 His GTG g CCCG aacagaaagg G - C T - A G - C G - C G + T C - G G - C T G T T G C C C A T G A A + | | | | G T C T T G G C G G G C G | | + | T T G G A G C T A A CTGTC C - G C - G A - T G - C G - C T T T A G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |