Sequence ID | >SRA1015989 |
Genome ID | SRR023846.295219 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 70 |
End posion on genome | 141 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
tgagctgggt |
tRNA gene sequence |
GCTCTTATGGTGTAATGGTTAGCACTCTGGACTTTGAATCCAGCGATCCGGGTTCAAATC |
Downstream region at tRNA end position |
tttgtgcgcg |
Secondary structure (Cloverleaf model) | >SRA1015989 Gln TTG t Ttgt tttgtgcgcg G - C C - G T - A C - G T + G T - A A - T T A T G G C C C A T A A G | | | | | A G T G T G C C G G G C G + | | | T T T G C A C T A T CGAT C - G T - A G - C G - C A - T C A T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |