Sequence ID | >SRA1015992 |
Genome ID | SRR023846.296329 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 85 |
End posion on genome | 162 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
cgtcgaacat |
tRNA gene sequence |
GGGGCCTTAGCTCAGCTGGGAGAGCGGTTGCTTTGCAAGCATCAGGTCATCGGTTCGATC |
Downstream region at tRNA end position |
tcgttttgag |
Secondary structure (Cloverleaf model) | >SRA1015992 Ala TGC t ACCA tcgttttgag G G G - C G - C G + T C C C - G T + G C C T G A T A G C C G A A | + | + T T C T C G C G G T T A G | | | | C G G G A G C G A G AGGTCAT G - C T T T - A G - C C - G T A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |