Sequence ID | >SRA1015993 |
Genome ID | SRR023846.298210 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 230 |
End posion on genome | 158 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
nnncacgcac |
tRNA gene sequence |
GCCCCTATAGCTCAGTGGTAGAGCACTCGCTTCGTAAGCGAAAGGTCGGTGGTTCGATCC |
Downstream region at tRNA end position |
cttttgctta |
Secondary structure (Cloverleaf model) | >SRA1015993 Thr CGT c TCgt cttttgctta G - C C - G C - G C - G C - G T + G A - T C T T C C G C C A G A A | | + | | G T C T C G G G T G G C G | | | | T T G G A G C T A A AGGTC C A T - A C - G G - C C - G T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |