Sequence ID | >SRA1015994 |
Genome ID | SRR023846.298308 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 13 |
End posion on genome | 88 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
gaagttacga |
tRNA gene sequence |
AGGGGTATAGCTCAATTGGCAGAGCGTCGGTCTCCAAAACCGAAGGTTGTAGGTTCGATT |
Downstream region at tRNA end position |
cctgaaggtg |
Secondary structure (Cloverleaf model) | >SRA1015994 Trp CCA a GCCA cctgaaggtg A - T G - C G - C G - C G - C T + G A - T T T T C A T C C A T A A A | | | | | G T C T C G G T A G G C G | | | | T T G G A G C C A G AGGTT T - A C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |