Sequence ID | >SRA1016003 |
Genome ID | SRR023846.305565 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 133 |
End posion on genome | 209 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
agcgatatga |
tRNA gene sequence |
CGGAGTATAGCGCAGCCCGGTAGCGCACCTGTCTGGGGGACAGGGGGTCGCAGGTTCAAG |
Downstream region at tRNA end position |
atcaaagcac |
Secondary structure (Cloverleaf model) | >SRA1016003 Pro GGG a ACCA atcaaagcac C - G G - C G - C A - T G - C T - A A - T T G T C G T C C A C G A A | | | | | A C C G C G G C A G G C C | | | | T T G G C G C G T A A GGGTC C - G C - G T - A G - C T - A C G T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |