Sequence ID | >SRA1016004 |
Genome ID | SRR023846.305713 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 73 |
End posion on genome | 144 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
tgtgtagttg |
tRNA gene sequence |
GCGCTCGTGGTCTAGTGGTTATGATCGTCGCTTGCCAAGTGATGGACCCGGGTTCAATTC |
Downstream region at tRNA end position |
attttttttt |
Secondary structure (Cloverleaf model) | >SRA1016004 Gly GCC g Aaaa attttttttt G - C C - G G - C C - G T - A C - G G - C T T T G G C C C A T G A G | | | | | A G T C T G C C G G G C G | | + T T T T G A T T A C GGAC G + T T - A C - G G + T C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |