Sequence ID | >SRA1016016 |
Genome ID | SRR023846.313241 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 198 |
End posion on genome | 270 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
ttattattaa |
tRNA gene sequence |
GGGACTTTAGTATAATGGTTAATATTTATGACTTTTAATCATTAAGATATTGGTTCGAAT |
Downstream region at tRNA end position |
aagcgattat |
Secondary structure (Cloverleaf model) | >SRA1016016 Lys TTT a Aata aagcgattat G + T G - C G - C A - T C - G T + G T - A T A T T A A C C A T A A A | | | | | G G T A T G A T T G G C G | | | + T T T A T A T T A T AAGAT T T A - T T - A G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |