Sequence ID | >SRA1016017 |
Genome ID | SRR023846.313347 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 54 |
End posion on genome | 128 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
ccggcaacgt |
tRNA gene sequence |
TCCCTGATAGCTCAGCGGTAGAGCTCTCGACTGTTAATCGAGTGGCCGTAGGTTCGAATC |
Downstream region at tRNA end position |
tttcctcgtt |
Secondary structure (Cloverleaf model) | >SRA1016017 Asn GTT t GCCA tttcctcgtt T - A C - G C - G C - G T - A G - C A - T T A T C A T C C A G A A | | | | | G C C T C G G T A G G C G | | | | T T G G A G C T A T TGGCC C - G T - A C - G G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |