Sequence ID | >SRA1016026 |
Genome ID | SRR023846.316771 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 232 |
End posion on genome | 156 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
tgaccggctt |
tRNA gene sequence |
GGGTCTGTAGCTCAGTTGGTTAGAGCACCGTCTTGATAAGGCGGGGGTCGTTGGTTCGAT |
Downstream region at tRNA end position |
tcccctccag |
Secondary structure (Cloverleaf model) | >SRA1016026 Ile GAT t ACCA tcccctccag G - C G - C G - C T - A C - G T - A G - C T T T C A A C C A T G A A | | | | | G T C T C G G T T G G C G | | | | T T G G A G C T T A A GGGTC C - G C - G G - C T + G C - G T A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |