Sequence ID | >SRA1016031 |
Genome ID | SRR023846.317355 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 164 |
End posion on genome | 88 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
taagcagaaa |
tRNA gene sequence |
CGGGGTATAGCGCAGTCCGGTAGCGCGCCTGCTTTGGGAGCAGGATGTCAGGAGTTCGAA |
Downstream region at tRNA end position |
ttttcacttg |
Secondary structure (Cloverleaf model) | >SRA1016031 Pro TGG a ACCA ttttcacttg C - G G - C G - C G - C G - C T - A A - T T A T T C C C C A T G A A | | | | G C C G C G A G G A G C C | | | | T T G G C G C G T A G ATGTC C - G C - G T - A G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |