Sequence ID | >SRA1016033 |
Genome ID | SRR023846.317854 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 145 |
End posion on genome | 221 |
Amino Acid | Sup |
Anticodon | CTA |
Upstream region at tRNA start position |
atacacacat |
tRNA gene sequence |
GCGCAATTAGCTCAGTTGGTCAGAGTAGGAGCCTCTAAAACTCACGGTCATCGGTTCGAT |
Downstream region at tRNA end position |
aaataactaa |
Secondary structure (Cloverleaf model) | >SRA1016033 Sup CTA t ACCA aaataactaa G - C C - G G - C C - G A - T A - T T - A C T T T A G C C A T G A A | | | | | G T C T C G A T C G G C G | | | + T T G G A G T T C A A CGGTC G A G - C A - T G - C C A C A T A C T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |