Sequence ID | >SRA1016034 |
Genome ID | SRR023846.317978 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 179 |
End posion on genome | 255 |
Amino Acid | Arg |
Anticodon | TCG |
Upstream region at tRNA start position |
tttaatagaa |
tRNA gene sequence |
GCGCGGCTGGCGCAATGGATAGCGTATCAGACTTCGAATCTGGGGGGTTGCGGGTTCGAG |
Downstream region at tRNA end position |
ttttgttttg |
Secondary structure (Cloverleaf model) | >SRA1016034 Arg TCG a ACAA ttttgttttg G + T C - G G - C C - G G - C G + T C - G T G T C G C C C A T A A G | | | | | G G C G C G G C G G G C G | | | + T T A G C G T T A A GGGGTT T + G C - G A - T G - C A - T C A T A T C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |