Sequence ID | >SRA1016046 |
Genome ID | SRR023846.323443 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 118 |
End posion on genome | 35 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
attatttaaa |
tRNA gene sequence |
GGAGAAATGGCTGAGTGGTTAAAAGCGGCAGACTGTAAATTTGTTGAATAAATTTCTACG |
Downstream region at tRNA end position |
aatcaataat |
Secondary structure (Cloverleaf model) | >SRA1016046 Tyr GTA a Aaat aatcaataat G - C G - C A - T G - C A - T A - T A - T T A T C A T C C A T G A G | | + | | A G G T C G G T G G G C G | | | T T T A A G C T A A G TGAATAAATTTCTAC G + T C - G A - T G + T A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |