Sequence ID | >SRA1016051 |
Genome ID | SRR023846.325981 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 89 |
End posion on genome | 16 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
gcatcgaaat |
tRNA gene sequence |
GCGGGAGTAGTTCAATGGTAGAACCCTAGCCTTCCAAGCTAATGACGCGGGTTCGATTCC |
Downstream region at tRNA end position |
cgggatccgt |
Secondary structure (Cloverleaf model) | >SRA1016051 Gly TCC t TCCA cgggatccgt G - C C - G G - C G - C G - C A - T G - C T T T T G C C C A A A A + | | | | G T C T T G G C G G G C G | | | | T T G G A A C T A C TGAC C A T - A A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |