Sequence ID | >SRA1016056 |
Genome ID | SRR023846.326722 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 125 |
End posion on genome | 211 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
tgtttcatgg |
tRNA gene sequence |
GCGGCCATGGCGGAACTGGTAGACGCGCAACGTTGAGGTCGTTGTGGGCGAAAGCCCGTG |
Downstream region at tRNA end position |
ttttctacag |
Secondary structure (Cloverleaf model) | >SRA1016056 Leu GAG g ACCA ttttctacag G - C C - G G - C G - C C - G C - G A - T T G T T C T T C A C A A G + | | | | G T G G C G G G A A G C G | | | T T G A C G C T A G G TGGGCGAAAGCCCGT C - G A - T A - T C - G G - C T T T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |