Sequence ID | >SRA1016063 |
Genome ID | SRR023846.333499 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 68 |
End posion on genome | 142 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
cgtttgagcc |
tRNA gene sequence |
AGCACTTTGGCGCAGAGGAAGCGTGTTGGGCTCATAACCCAAAGGTCGTTGGATCGAGAC |
Downstream region at tRNA end position |
ttatccacgc |
Secondary structure (Cloverleaf model) | >SRA1016063 Met CAT c ATCA ttatccacgc A - T G - C C - G A - T C - G T - A T - A A G T C A A C C A G A G | | | | | G A C G C G G T T G G C G | | | + A T G G C G T A A G AGGTC T - A T - A G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |