Sequence ID | >SRA1016064 |
Genome ID | SRR023846.333570 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 111 |
End posion on genome | 36 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
gagagacaaa |
tRNA gene sequence |
GGGTGATTAGCTCAGCCGGGAGAGCATCTGCCTTACAAGCAGAGGGTCGGCGGTTCGATC |
Downstream region at tRNA end position |
atctctctca |
Secondary structure (Cloverleaf model) | >SRA1016064 Val TAC a ACCA atctctctca G - C G - C G - C T - A G - C A - T T - A C T T C T G C C A C G A A | + | | | G C C T C G G G C G G C G | | | | T T G G A G C G A A GGGTC T - A C - G T - A G - C C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |