Sequence ID | >SRA1016080 |
Genome ID | SRR023846.339823 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 122 |
End posion on genome | 47 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
gttgagaggc |
tRNA gene sequence |
GTCCCCGTGGCCCAATGGATAAGGCATCCGCCTACGAAGCGGGAGATTGCGGGTTCGAGT |
Downstream region at tRNA end position |
ttttgtctcc |
Secondary structure (Cloverleaf model) | >SRA1016080 Arg ACG c TTCA ttttgtctcc G - C T - A C - G C A C - G C - G G - C T G T T G C C C A T A A G + | | | | G G C C C G G C G G G C G | | | T T A A G G C T A A AGATT T + G C - G C - G G - C C - G C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |