Sequence ID | >SRA1016082 |
Genome ID | SRR023846.341374 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 87 |
End posion on genome | 12 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
agtcccacac |
tRNA gene sequence |
GGGCGATTGGCGCAGTTGGTAGCGCGCTTCCTTCACACGGAAGAGGTCATCGGTTCGAGC |
Downstream region at tRNA end position |
tcatcatcga |
Secondary structure (Cloverleaf model) | >SRA1016082 Val CAC c ACGA tcatcatcga G - C G - C G - C C - G G - C A - T T - A C G T T G G C C A T G A G | + | | | G T C G C G A T C G G C G | | | | T T G G C G C T A G AGGTC C - G T - A T - A C - G C - G T C T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |