Sequence ID | >SRA1016091 |
Genome ID | SRR023846.343495 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 27 |
End posion on genome | 101 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
tcccgcagat |
tRNA gene sequence |
GGCCCCTTCGTCTAGCGGTTAGGACGTCGCCCTCTCACGGCGAAAACACGAGTTCGATTC |
Downstream region at tRNA end position |
agcgcagaaa |
Secondary structure (Cloverleaf model) | >SRA1016091 Glu CTC t ACCA agcgcagaaa G - C G + T C - G C - G C - G C - G T - A T T T T G C T C A C G A C | | | | | G G T C T G A C G A G C G + | | | T T T G G A C T A G AAAC T - A C - G G - C C - G C - G C C T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |