Sequence ID | >SRA1016109 |
Genome ID | SRR023846.351260 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 205 |
End posion on genome | 121 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
aaacaccctc |
tRNA gene sequence |
GCCCGGGTGGCGGAATAGGTAGACGCAGGGGACTCAAAATCCCCCGCCGCAAGGCGTGCC |
Downstream region at tRNA end position |
aatgtgatga |
Secondary structure (Cloverleaf model) | >SRA1016109 Leu CAA c ACCA aatgtgatga G - C C - G C - G C - G G - C G + T G - C T T T C G G C C A T A A G | | | | | G A G G C G G C C G G C G | | | T T G A C G C T A G A CGCCGCAAGGCGT G - C G - C G - C G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |