Sequence ID | >SRA1016126 |
Genome ID | SRR023846.357313 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 88 |
End posion on genome | 177 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
caaaccacac |
tRNA gene sequence |
AGAGAGCTGCCGGAGTGGTCGAACGGGTCTGATTCGAAATCAGAAGTACTCGCAAGGGTA |
Downstream region at tRNA end position |
aaaggcgtat |
Secondary structure (Cloverleaf model) | >SRA1016126 Ser CGA c GCCA aaaggcgtat A - T G - C A - T G - C A - T G - C C - G T A T C T C C C A T G A G | + | | | G G G G C C G G G G G C G | | | T T T A C G G C G A G AGTACTCGCAAGGGTACC T - A C - G T - A G - C A - T T A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |