Sequence ID | >SRA1016128 |
Genome ID | SRR023846.358402 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 307 |
End posion on genome | 222 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
aatcgcctga |
tRNA gene sequence |
GCCAGAGTGGTGTAATGGTAGCCACGAGGGACTTAAAATCCCTTGTCTTCACGGACGTAC |
Downstream region at tRNA end position |
aaaaccccgt |
Secondary structure (Cloverleaf model) | >SRA1016128 Leu TAA a ACTA aaaaccccgt G + T C - G C - G A - T G - C A - T G - C T G T T G C C C A T A A G | | | | | G G T G T G A C G G G C G | | | T T T C C A C A G G TGTCTTCACGGACGT A - T G - C G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |