Sequence ID | >SRA1016146 |
Genome ID | SRR023846.369079 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 55 |
End posion on genome | 130 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
ggtcggtccc |
tRNA gene sequence |
GCCGCTTTAGCTCAGTCGGTAGAGCGTCTCACTCGTAATGAGAAGGTCATCAGTTCGATT |
Downstream region at tRNA end position |
ccacagcccc |
Secondary structure (Cloverleaf model) | >SRA1016146 Thr CGT c TCCA ccacagcccc G - C C - G C - G G - C C - G T - A T - A T T T T A G T C A T G A A | | | | | G C C T C G A T C A G C G | | | | T T G G A G C T A G AGGTC T - A C - G T - A C - G A - T C A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |