Sequence ID | >SRA1016153 |
Genome ID | SRR023846.371896 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 186 |
End posion on genome | 269 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
gggggtgtgt |
tRNA gene sequence |
GCGGACGTGGCGAAACCGGTAGACGCAGGAGACTTAAAATCTCCCTCCCTAGGAGTGCGG |
Downstream region at tRNA end position |
aagcggctct |
Secondary structure (Cloverleaf model) | >SRA1016153 Leu TAA t ACCA aagcggctct G - C C - G G - C G - C A - T C - G G - C T G T C G C C C A C A A G | | | | | G C A G C G G C G G G C G | | | T T G A C G C T A G A CTCCCTAGGAGT G - C G - C A - T G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |