Sequence ID | >SRA1016173 |
Genome ID | SRR023846.378591 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 242 |
End posion on genome | 169 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
cgccggcttc |
tRNA gene sequence |
GCGGGTATAGTACAATGGTAGTACAGCAGCCTTCCAAGCTGAATACACGGGTTCGATTCC |
Downstream region at tRNA end position |
ccctattctt |
Secondary structure (Cloverleaf model) | >SRA1016173 Gly TCC c TCCA ccctattctt G - C C - G G - C G - C G - C T - A A - T T T T T G C C C A A A A | | | | | G T C A T G A C G G G C G | | | | T T G G T A C T A A ATAC G A C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |