Sequence ID | >SRA1016186 |
Genome ID | SRR023846.388656 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 48 |
End posion on genome | 121 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
cccggagttt |
tRNA gene sequence |
TCGGGGCTCGTCTAACGGTAGGACACCGGGTTCTGGTCCCGTGAATTGGGGTTCGAATCC |
Downstream region at tRNA end position |
gttcaaggtt |
Secondary structure (Cloverleaf model) | >SRA1016186 Gln CTG t TCCA gttcaaggtt T - A C - G G - C G - C G - C G - C C - G T A T G T C C C A A A C + + | | | G C T C T G T G G G G C G + | | | T T G G G A C T A A GAAT C T C - G G - C G - C G - C T T T G C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |