Sequence ID | >SRA1016191 |
Genome ID | SRR023846.392709 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 250 |
End posion on genome | 177 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
ccctcgctga |
tRNA gene sequence |
TGCCCCGTCGTCTAATGGTAAGACTGCGGTTTCTGATACCGCCTATTGAGGTTCGAATCC |
Downstream region at tRNA end position |
gcgcttcctg |
Secondary structure (Cloverleaf model) | >SRA1016191 Gln CTG a TCCA gcgcttcctg T - A G - C C - G C - G C - G C - G G - C T A T A C T C C A A A C | | | | | G T T C T G T G A G G C G | | | | T T G A G A C T A T CTAT G - C C - G G - C G - C T - A T T T A C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |