Sequence ID | >SRA1016199 |
Genome ID | SRR023846.397119 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 93 |
End posion on genome | 9 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
tacacggcgt |
tRNA gene sequence |
GCGGTCGTGGCGGAATTGGTAGACGCGCAGCGTTGAGGTCGCTGTGGGGCAACCCGTGGA |
Downstream region at tRNA end position |
gccttgctnn |
Secondary structure (Cloverleaf model) | >SRA1016199 Leu GAG t ACCA gccttgctnn G - C C - G G - C G - C T - A C - G G - C T G T T C T T C A T A A G + | | | | G T G G C G G G A A G C G | | | T T G A C G C T A G G TGGGGCAACCCGT C - G A - T G - C C - G G - C T T T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |