Sequence ID | >SRA1016201 |
Genome ID | SRR023846.397261 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 60 |
End posion on genome | 135 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
taagtgacat |
tRNA gene sequence |
AGGGTAGTAGCGCAGCTGGTAGCGCGCGGCATTTGGGATGCTGAGGTCGTCAGTTCGAGT |
Downstream region at tRNA end position |
attaatgaag |
Secondary structure (Cloverleaf model) | >SRA1016201 Pro TGG t ACGA attaatgaag A - T G - C G - C G - C T - A A - T G + T T G T C G G T C A C G A A | + | | | G T C G C G G T C A G C G | | | | T T G G C G C T A G AGGTC C - G G + T G - C C - G A - T T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |