Sequence ID | >SRA1016202 |
Genome ID | SRR023846.397300 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 189 |
End posion on genome | 114 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
gacccggcac |
tRNA gene sequence |
GGCCAGGTAGCTCAGTTGGTAGAGCGTCCGACTGAAAATCGGAAGGTCAGCGGTTCGACC |
Downstream region at tRNA end position |
ggatcacgta |
Secondary structure (Cloverleaf model) | >SRA1016202 Phe GAA c ACCT ggatcacgta G - C G - C C - G C - G A - T G - C G - C C C T T C G C C A T G A A | | | | | G T C T C G A G C G G C G | | | | T T G G A G C T A G AGGTC T - A C - G C - G G - C A - T C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |