Sequence ID | >SRA1016204 |
Genome ID | SRR023846.401391 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 9 |
End posion on genome | 91 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
ntagcacaaT |
tRNA gene sequence |
GACAGCTTCGCCGAGTGGTTAAGGCGTTAGCCTGCTAAGTTAATGGGGCAACCCGCGTGA |
Downstream region at tRNA end position |
ttcttatctc |
Secondary structure (Cloverleaf model) | >SRA1016204 Ser GCT T GTtt ttcttatctc G - C A - T C - G A - T G - C C - G T - A T A T C A C T C A T G A C | | | | | G G G C C G G T G A G C G | | | T T T A G G C T A G TGGGGCAACCCGC T - A T - A A - T G + T C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |