Sequence ID | >SRA1016209 |
Genome ID | SRR023846.404417 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 116 |
End posion on genome | 189 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
ggaccaccgg |
tRNA gene sequence |
AGGGCACTAGCTCAACTGGCAGAGCATCGGTCTCCAAAACCGAAGGTTGGGGGTTCAAGT |
Downstream region at tRNA end position |
gacggcagca |
Secondary structure (Cloverleaf model) | >SRA1016209 Trp CCA g GCag gacggcagca A - T G - C G - C G - C C - G A - T C - G T G T C T C C C A C A A A | + | | | A T C T C G G G G G G C G | | | | T T G G A G C C A A AGGTT T - A C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |