Sequence ID | >SRA1016213 |
Genome ID | SRR023846.405192 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 61 |
End posion on genome | 148 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
ccggccaccg |
tRNA gene sequence |
GGAGGGCTGTCCGAGCGGCCGATGGAGCTTGTCTTGAAAACAAGTGGGCAGAGATGTCTC |
Downstream region at tRNA end position |
gtcgggtcgc |
Secondary structure (Cloverleaf model) | >SRA1016213 Ser TGA g GCCG gtcgggtcgc G - C G - C A - T G - C G - C G - C C - G T A T C A C C C A C G A G | | | | | G G G C C T G T G G G C G + | | | T T C T G G A C G A G TGGGCAGAGATGTCTC C - G T - A T - A G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |