Sequence ID | >SRA1016218 |
Genome ID | SRR023846.406364 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 259 |
End posion on genome | 183 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
ttgcaaatac |
tRNA gene sequence |
GGCCCCATCGTATAGCGGCCTAGTACGTCGCCCTCTCACGGCGGTAACACGGGTTCGAAT |
Downstream region at tRNA end position |
Agcaccgaca |
Secondary structure (Cloverleaf model) | >SRA1016218 Glu CTC c CACC Agcaccgaca G + T G G C - G C - G C - G C - G A - T T A T T G C C C A C G A C | | | | | G G T A T G A C G G G C G + | | | T T C G T A C C T A G TAAC T + G C - G G - C C - G C - G C C T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |