Sequence ID | >SRA1016227 |
Genome ID | SRR023846.409333 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 154 |
End posion on genome | 78 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tccatcttgc |
tRNA gene sequence |
CGCGCGATGGAGCAGCCTGGTAGCTCGTTGGGCTCATAACCCAAAGGTCGCAAGTTCAAA |
Downstream region at tRNA end position |
attgaagggc |
Secondary structure (Cloverleaf model) | >SRA1016227 Met CAT c ACCA attgaagggc C A G - C C - G G - C C - G G - C A - T T A T C G T T C A C G A G | | | | | A C C G A G G C A A G C T | | | | T T G G C T C G T A G AGGTC T - A T - A G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |