Sequence ID | >SRA1016229 |
Genome ID | SRR023846.409525 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 192 |
End posion on genome | 111 |
Amino Acid | Ser |
Anticodon | AGA |
Upstream region at tRNA start position |
aggttttaaC |
tRNA gene sequence |
GACAGCTTGGCCGAGTGGTTTAAGGCGATAGACTAGAAATCTATTGGGTAACCGCGTGAG |
Downstream region at tRNA end position |
ccttttttgc |
Secondary structure (Cloverleaf model) | >SRA1016229 Ser AGA C GAac ccttttttgc G - C A - T C - G A - T G - C C - G T - A T A T C A C T C A T G A G | | | | | A G G C C G G T G A G C G | | | T T T A G G C T T A G TGGGTAACCGC A - T T - A A - T G - C A - T C A T A A G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |