Sequence ID | >SRA1016232 |
Genome ID | SRR023846.410339 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 119 |
End posion on genome | 43 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
caacaccctt |
tRNA gene sequence |
GCGGTCGTAGCCCAACCGGATACGGCGCCGACCTCCAAAGTCGGACATTGCAGGTTCGAG |
Downstream region at tRNA end position |
tcccgggagg |
Secondary structure (Cloverleaf model) | >SRA1016232 Trp CCA t GCCA tcccgggagg G + T C - G G - C G - C T - A C - G G - C T G T T G T C C A C A A A + | | | | G C C C C G G C A G G C G | | | T T G C G G C A T A G ACATT C - G C - G G - C A - T C - G C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |