Sequence ID | >SRA1016246 |
Genome ID | SRR023846.416980 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 8 |
End posion on genome | 81 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
nnnttattta |
tRNA gene sequence |
AGGGGATTAGTTGAGTGGTTTAACACCGGTCTTACACACTGGATACAGAGGTTCGATTCC |
Downstream region at tRNA end position |
aattaaaata |
Secondary structure (Cloverleaf model) | >SRA1016246 Val TAC a ACAA aattaaaata A - T G + T G - C G - C G + T A - T T - A T T T T C T C C A G A A | | | | | G T G T T G A G A G G C G + | | | T T G T A A C T T A ATAC C - G C - G G + T G - C T - A C C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |