Sequence ID | >SRA1016269 |
Genome ID | SRR023846.429589 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 86 |
End posion on genome | 161 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
ttacgtcacc |
tRNA gene sequence |
GCCCCTATGGCTCAGTGGTTAGAGCACCGGTCTTGTAAACCGGGGGTCGGGAGTTCGAAT |
Downstream region at tRNA end position |
cgccctgttt |
Secondary structure (Cloverleaf model) | >SRA1016269 Thr TGT c ACGA cgccctgttt G - C C - G C - G C - G C - G T + G A - T T A T C C C T C A T G A G | | | | | G G C T C G G G G A G C G | | | | T T T G A G C T A A GGGTC C - G C - G G - C G - C T - A C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |