Sequence ID | >SRA1016270 |
Genome ID | SRR023846.429944 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 203 |
End posion on genome | 127 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
ctggcaccca |
tRNA gene sequence |
GACTCCGTAGCTCAGCTGGATAGAGCAGCCGCCTTCTAAGCGGCAGGTCGTAGGTTCGAG |
Downstream region at tRNA end position |
gatcagccct |
Secondary structure (Cloverleaf model) | >SRA1016270 Arg TCT a GCCA gatcagccct G - C A - T C - G T + G C - G C - G G - C C G T C A T C C A C G A A | | | | | G T C T C G G T A G G C G | | | | T T G G A G C A T A A AGGTC G - C C - G C - G G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |