Sequence ID | >SRA1016283 |
Genome ID | SRR023846.435637 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 118 |
End posion on genome | 189 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
tagcatcaag |
tRNA gene sequence |
GCGTGGCTGGTGTAATGGTTAGCATTGCTGCCTTCCAAGCAGTAGATCCGGGTTCAATTC |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >SRA1016283 Gly TCC g Agnn nnnnnnnnnn G - C C - G G - C T - A G - C G - C C - G T T T G G C C C A T A A G | | | | | A G T G T G C C G G G C G + | | + T T T G C A T T A T AGAT G + T C - G T - A G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |