Sequence ID | >SRA1016285 |
Genome ID | SRR023846.435720 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 227 |
End posion on genome | 300 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
aatgaacacA |
tRNA gene sequence |
GCCGGTATGGCCAAGTGGCAAGGCAACCGCTTCGTAAGCGGTAGATCGGGGGTTCGATCC |
Downstream region at tRNA end position |
attttaatta |
Secondary structure (Cloverleaf model) | >SRA1016285 Thr CGT A TAaa attttaatta G - C C - G C - G G - C G - C T + G A - T C T T C C C C C A G A G | | | | | G T A C C G G G G G G C G | | | T T G A G G C C A A AGATC A - T C - G C - G G - C C - G T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |