Sequence ID | >SRA1016287 |
Genome ID | SRR023846.436984 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 209 |
End posion on genome | 138 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
agggttcgac |
tRNA gene sequence |
GCGCGGGTAGCTCAGTGGTAGAGCGTTCGATTGCAGCTCGAAGGGTCACTGGTTCAATCC |
Downstream region at tRNA end position |
tgttcttgtc |
Secondary structure (Cloverleaf model) | >SRA1016287 Cys GCA c Ttct tgttcttgtc G - C C - G G - C C - G G - C G - C G - C C T T T G G C C A G A A | | + | | A T C T C G A C T G G C G | | | | T T G G A G C T A G GGGTC T - A T - A C - G G - C A - T T C T G G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |