Sequence ID | >SRA1016290 |
Genome ID | SRR023846.437828 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 11 |
End posion on genome | 86 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
ccatcgtcgg |
tRNA gene sequence |
GCCGCTTTAGCTCAGCTGGTAGAGCATCGCATTCGTAATGCGGGGGTCACAGGTTCGAGT |
Downstream region at tRNA end position |
aattccagat |
Secondary structure (Cloverleaf model) | >SRA1016290 Thr CGT g ACCA aattccagat G - C C - G C - G G - C C - G T - A T - A T G T T G T C C A C G A A | | | | | G T C T C G A C A G G C G | | | | T T G G A G C T A A GGGTC T + G C - G G - C C - G A - T T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |